Author Correction: Engineered promoters enable constant gene expression at any copy number in bacteria

Thomas H. Segall-Shapiro; Eduardo D. Sontag; Christopher A. Voigt

doi:10.1038/s41587-022-01300-7

Author Correction: Engineered promoters enable constant gene expression at any copy number in bacteria

Thomas H. Segall-Shapiro, Eduardo D. Sontag, Christopher A. Voigt

Houston Methodist

Research output: Contribution to journal › Comment/debate › peer-review

1 Scopus citations

Abstract

In this article, the bottom right panel of Fig. 4a is labeled “TALEsp2 stabilized” and the dashed blue curve in the bottom left panel is identified as the geometric mean of the TALEsp2 stabilized induction curves. In both cases, TALEsp2 should have read TALEsp1. In the Supplementary Information originally posted for this article, the RBSsp2 sequence in Supplementary Table 3 was shown as ATCAATTCATCGACGTGAAA; the correct sequence is ATCAATTCATCGATGTGAAA. This sequence was incorporated into that of the TALEsp2 stabilized promoter used in plasmids pTHSSe_60 and pTHSSf_27-38, 40, 98, and the genomic insertion of pTHSSf_40. The revised Supplementary Information is available in this notice.

Original language	English (US)
Pages (from-to)	799
Number of pages	1
Journal	Nature Biotechnology
Volume	40
Issue number	5
DOIs	https://doi.org/10.1038/s41587-022-01300-7
State	Published - May 2022

ASJC Scopus subject areas

Biotechnology
Bioengineering
Applied Microbiology and Biotechnology
Molecular Medicine
Biomedical Engineering

Access to Document

10.1038/s41587-022-01300-7

Cite this

@article{907bbca13bfd4a939ad026c1b3234a15,

title = "Author Correction: Engineered promoters enable constant gene expression at any copy number in bacteria",

abstract = "In this article, the bottom right panel of Fig. 4a is labeled “TALEsp2 stabilized” and the dashed blue curve in the bottom left panel is identified as the geometric mean of the TALEsp2 stabilized induction curves. In both cases, TALEsp2 should have read TALEsp1. In the Supplementary Information originally posted for this article, the RBSsp2 sequence in Supplementary Table 3 was shown as ATCAATTCATCGACGTGAAA; the correct sequence is ATCAATTCATCGATGTGAAA. This sequence was incorporated into that of the TALEsp2 stabilized promoter used in plasmids pTHSSe_60 and pTHSSf_27-38, 40, 98, and the genomic insertion of pTHSSf_40. The revised Supplementary Information is available in this notice.",

author = "Segall-Shapiro, {Thomas H.} and Sontag, {Eduardo D.} and Voigt, {Christopher A.}",

year = "2022",

month = may,

doi = "10.1038/s41587-022-01300-7",

language = "English (US)",

volume = "40",

pages = "799",

journal = "Nature Biotechnology",

issn = "1087-0156",

publisher = "Nature Publishing Group",

number = "5",

}

TY - JOUR

T1 - Author Correction

T2 - Engineered promoters enable constant gene expression at any copy number in bacteria

AU - Segall-Shapiro, Thomas H.

AU - Sontag, Eduardo D.

AU - Voigt, Christopher A.

PY - 2022/5

Y1 - 2022/5

N2 - In this article, the bottom right panel of Fig. 4a is labeled “TALEsp2 stabilized” and the dashed blue curve in the bottom left panel is identified as the geometric mean of the TALEsp2 stabilized induction curves. In both cases, TALEsp2 should have read TALEsp1. In the Supplementary Information originally posted for this article, the RBSsp2 sequence in Supplementary Table 3 was shown as ATCAATTCATCGACGTGAAA; the correct sequence is ATCAATTCATCGATGTGAAA. This sequence was incorporated into that of the TALEsp2 stabilized promoter used in plasmids pTHSSe_60 and pTHSSf_27-38, 40, 98, and the genomic insertion of pTHSSf_40. The revised Supplementary Information is available in this notice.

AB - In this article, the bottom right panel of Fig. 4a is labeled “TALEsp2 stabilized” and the dashed blue curve in the bottom left panel is identified as the geometric mean of the TALEsp2 stabilized induction curves. In both cases, TALEsp2 should have read TALEsp1. In the Supplementary Information originally posted for this article, the RBSsp2 sequence in Supplementary Table 3 was shown as ATCAATTCATCGACGTGAAA; the correct sequence is ATCAATTCATCGATGTGAAA. This sequence was incorporated into that of the TALEsp2 stabilized promoter used in plasmids pTHSSe_60 and pTHSSf_27-38, 40, 98, and the genomic insertion of pTHSSf_40. The revised Supplementary Information is available in this notice.

UR - http://www.scopus.com/inward/record.url?scp=85127651377&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=85127651377&partnerID=8YFLogxK

U2 - 10.1038/s41587-022-01300-7

DO - 10.1038/s41587-022-01300-7

M3 - Comment/debate

C2 - 35393562

AN - SCOPUS:85127651377

SN - 1087-0156

VL - 40

SP - 799

JO - Nature Biotechnology

JF - Nature Biotechnology

IS - 5

ER -

Author Correction: Engineered promoters enable constant gene expression at any copy number in bacteria

Abstract

ASJC Scopus subject areas

Access to Document

Other files and links

Fingerprint

Cite this